DNA Identification
Background
The human cells usually contains 46 chromosomes, made up of 22 pairs of chromosomes numbered according to size from 1-22 and two sex chromosome (X and Y). Females have 22 numbered chromosomes and two copies of the X chromosome (22 + XX); males have 22 numbered chromosomes and an X and a Y (22 + XY). Each chromosome is a strand of DNA, made up of a string of genes (coding DNA) separated by non-coding DNA. The sequence of letters making up the DNA has now largely been identified. Scientists can identify particular spots along the DNA strand at which genes are located or where sequences of DNA in the non-coding regions useful for particular types of DNA analysis can be found. The location of known genes or DNA sequences ('markers') are called their loci (singular, locus).
A person's genotype is described as the information in their DNA. Each child inherits from their parents' one copy of each chromosome and therefore one copy of their parent's genes and 'markers' in the non-coding DNA. So each person has two copies of each gene and the non-coding DNA separating them containing the DNA 'markers'. The two copies of each gene or DNA markers are called 'alleles'. There may be small differences in the sequence of letters in the DNA of the alleles located on each chromosome pair or each allele may be exactly the same.
A DNA profile
Scientists examine the information in 10 different DNA markers in the non-coding DNA to produce a genotype - called a DNA profile - of a person that can be used in identification testing. The markers they look at are at loci where there are multiple repeats of certain triplets of letters in the DNA sequence like GAT, GAT, GAT etc. For example, the number of times that this triplet of letters is repeated in the sequence of DNA at a locus on chromosome number 3 where a marker called D3 is located could be 12, 13, 14, 15, 16, 17, 18 or 19. So there are 7 different possible forms or alleles at the D3 locus.
Any one person can only have two forms of this marker as each person only has two copies of chromosome 3. So a person's genotype for the D3 marker may be described as 14, 14 (see below) where the number of times that GAT is repeated in the sequence at that locus on both chromosome copies is 14. Another person may be described as 17,18 as he or she has the GAT sequence repeated 17 times at the D3 locus on one chromosome copy; the other copy has the sequence repeated 18 times at the D3 locus.
Other markers such as D13 contain repeats of a longer sequence ACAGAAGTCTGGGATGTGGA, ACAGAAGTCTGGGATGTGGA, etc. The number of repeats of this sequence of letters in the D13 marker that have been observed in the population are 8, 9, 10, 11, 12, 13, 14 or 15. A person may have this sequence repeated 10 times on one chromosome copy; on the other chromosome copy the marker may contain 12 repeats of this sequence. The person's genotype for D13 would be described as 10, 12.
In the Australian population the possible number of repeats of each triplet of letters at the loci of the ten markers listed below is known. By using 10 different loci, a person's DNA "profile" can be expressed that can identify them with a very high degree of accuracy.
| Marker | D3 | D13 | VWA | FGA | D8 | D21 | D18 | D5 | D7 | AMEL |
| Person 1 | 14, 14 | 10, 12 | 15, 18 | 19, 20 | 11, 13 | 31.2, 34.2 | 16, 19 | 11, 11 | 10, 10 | X, X |
| Person 2 | 17, 18 | 9, 14 | 17, 17 | 18, 22 | 13, 15 | 28, 30 | 10, 14 | 11, 11 | 11, 13 | X, Y |
The following exercises are examples of ways that DNA identification testing can be used.
